Primary Human Herpesvirus 6 Infection in Young Children ad

Reszta komórek (około 106 na mililitr) była hodowana świeżymi ludzkimi komórkami jednojądrzastymi z krwi pępowinowej w pożywce RPMI-1640 zawierającej antybiotyki, 10% inaktywowanej termicznie płodowej surowicy bydlęcej, 5 .g fitohemaglutyniny (Sigma Chemical, St. Louis) na mililitr, 5 procent (32 jednostki na mililitr) ludzkiej interleukiny-2 (Pharmacia Diagnostics, Silver Spring, MD) i 0,01 mg hydrokortyzonu (Sigma Chemical) na mililitr. Świeże i niezakażone jednojądrzaste komórki krwi pępowinowej dodawano raz w tygodniu. (HHV-6 nie został wykryty w komórkach krwi pępowinowej przez hodowlę powtarzalną lub w hodowanych jednojądrzastych komórkach od 20 zdrowych osób dorosłych.) Pozytywne kultury początkowo zidentyfikowano na podstawie charakterystycznego efektu cytopatycznego, z późniejszym potwierdzeniem przez pośrednie barwienie immunofluorescencyjne z surowicą. z kontroli pozytywnej, którą stanowiła surowica uzyskana podczas rekonwalescencji u dziecka z różyczką, której izolat HHV-6 scharakteryzowano jak opisano poniżej. Miano przeciwciała wobec HHV-6 w tej surowicy początkowo badano przez pośrednie barwienie immunofluorescencyjne przeciwko własnemu izolatowi dziecka i szczepowi Z29. Testy serologiczne HHV-6
Przeciwciało IgG przeciwko HHV-6 zostało określone za pomocą testu immunofluorescencji pośredniej ze szkiełkami komórek HSB-2 zakażonych izolatem HHV-6 uzyskanym od dziecka z różyczką. Ten izolat został scharakteryzowany jako HHV-6 przez PCR z dwoma zestawami starterów, tymi opisanymi w następnym rozdziale, oraz tymi opracowanymi przez Kondo i wsp., 16 jak również standardowym testem immunofluorescencji-przeciwciał przeciwko komplementarnym w Centers for Disease. Kontrolę i profile restrykcyjno-endonukleażowe, jak opisano poniżej. Dwukrotne rozcieńczenia (począwszy od 1:10) próbek surowicy w soli fizjologicznej buforowanej fosforanem dodano do szkiełek, inkubowano w 35 ° C i przemyto. Sprzężone z fluoresceiną koziej przeciwludzkiej IgG (Cappel, West Chester, PA) i 0,25 procent błękitu Evans dodano, a szkiełka ponownie inkubowano, płukano, montowano i czytano. Próbki surowicy pobrane podczas ostrej choroby i podczas rekonwalescencji były testowane jednocześnie, a każdy test obejmował zakażone i niezainfekowane komórki HSB-2 jako kontrole, z dodatnimi i ujemnymi próbkami surowicy i bez surowicy (sól fizjologiczna buforowana fosforanem).
Wykrywanie HHV-6 przez PCR
Figura 1. Figura 1. Specyficzność testu PCR HHV-6. Startery specyficzne dla HHV-6 zastosowano w oddzielnych reakcjach z ponad 100 000 kopii genomowych każdego heterologicznego wirusowego DNA i około 100 kopii homologicznego wirusowego DNA. Górny panel pokazuje produkty reakcji po rozdzieleniu w złożonych żelach agarozowych i barwieniu bromkiem etydyny. Prawy pas zawiera produkty reakcji pozytywnej kontroli z około 10 000 genomowych kopii homologicznego wirusa. Dolny panel pokazuje autoradiografy uzyskane po hybrydyzacji sekwencji sondy z DNA przeniesionym na membrany nylonowe z żelu pokazanego na górnym panelu. Autoradiograf został prześwietlony w celu wykazania braku produktów reagujących krzyżowo. HSV oznacza wirus opryszczki pospolitej, wirus VZV ospy wietrznej-półpaśca, wirus Epsteina-Barra wirusa EBV i cytomegalię wirusa CMV.
Sekwencje starterów i sond do PCR HHV-6 pochodziły z sekwencji DNA (dane niepublikowane) odcinka genomu HHV-6 (Z29) zlokalizowanego w pobliżu lewego końcowego powtórzenia.15 Sekwencje starterów HHV-6 były następujące. : primer A, 5 GTGATGTACGTGGCCGTCTCCTG; i starter B, 5 GATCCATGGTCGTCTTTCCACG
[przypisy: parafia chrystusa zbawiciela przasnysz, trifas, parafia zyrakow ]