Primary Human Herpesvirus 6 Infection in Young Children cd

Amplifikacja HHV-6 daje produkt o wielkości 384 bp. Komórki jednojądrzaste krwi obwodowej strawiono proteinazą K i 5 .l każdej próbki dodano do 95 .l mieszaniny reakcyjnej zawierającej polimerazę Tag (Promega, Madison, Wis.) I przygotowano zgodnie z zaleceniami Cetus Corporation. Do każdej próby włączono pozytywne i negatywne kontrole, w tym niezakażone jednojądrzaste komórki krwi pępowinowej i próbki bez matrycy mieszaniny reakcyjnej. Jako kontrolę wydajności stosowano startery beta-globiny.17 Procedura termocyklingu polegała na denaturacji w temperaturze 94 ° C przez pięć minut, 35 cyklach wyżarzania w temperaturze 55 ° C przez dwie minuty, wydłużaniu w temperaturze 72 ° C przez dwie minuty i denaturacji w temperaturze pokojowej. 94 ° C przez dwie minuty, a następnie końcowe wydłużanie w temperaturze 72 ° C przez siedem minut. Po elektroforezie w reakcji amplifikacji w złożonych żelach składających się z 3% agarozy NuSieve i 1% agaru z SeaPlaque (FMC BioProducts, Rockland, Me.) I plamienia na membranach nylonowych (Zeta-Probe, Bio-Rad Laboratories, Richmond, Calif), zamplifikowany fragment wykrywano przez hybrydyzację z sekwencją wewnętrznej sondy (5 CGTCTCGTATACCATTCCCAACC), która została wyznakowana na jej końcu 5 fosforem-32. Sekwencje starterów i sond nie wykazywały znacznego podobieństwa do jakiejkolwiek sekwencji w Gen-Bank i nie wytworzyły żadnego wykrywalnego reaktywnego krzyżowo produktu w reakcjach zawierających 105 genomowych kopii heterologicznych ludzkich herpeswirusów (Fig. 1). Profile z ograniczeniami endonukleazy
Całe zakażone komórki DNA przygotowano za pomocą standardowych procedur obejmujących trawienie proteinazą K, ekstrakcję fenol-chloroform i strącanie etanolem. Po strawieniu DNA odpowiednią endonukleazą restrykcyjną, uzyskane fragmenty rozdzielono w 0,8% żelu agarozowym, a następnie przeniesiono na błony nitrocelulozowe (Schleicher i Schuell, Keene, NH). DNA HHV-6 wykrywano przez hybrydyzację z wyznakowanym radioaktywnie pełnym wirusowym DNA oczyszczonym z nukleokapsydów, a fragment zawierający strukturę terminala-powtórzenia (TermL) otrzymano przez trawienie ClaI.18.
Wyniki
Charakterystyka kliniczna pacjentów
W badaniu wzięło udział dwieście czterdzieści trzy dzieci w wieku dwóch lat lub młodszych z ostrymi chorobami gorączkowymi. U 34 dzieci (14 procent) HHV-6 hodowano z krwi obwodowej uzyskanej w czasie pierwszej wizyty. Te dzieci były młodsze od tych z ujemnymi hodowlami HHV-6, ale nie znacząco (średnia wieku, odpowiednio 9,5 i 11,2 miesiąca), a 53 procent stanowiły chłopcy, w porównaniu z 59 procentami grupy z negatywnymi kulturami. Średni czas trwania objawów przed wizytą w oddziale ratunkowym był podobny w obu grupach – 2,7 dnia dla dzieci pozytywnych pod względem kulturowym i 2,8 dnia dla osób z negatywnymi kulturami.
Tabela 1. Tabela 1. Choroby gorączkowe rozpoznane w oddziale ratunkowym u dzieci, według HHV-6 Status ustalony w kulturze. Rozpoznanie ostrej choroby przebiegającej z gorączką u dzieci w momencie wypisu z pogotowia ratunkowego, zgodnie ze stanem serologicznym HHV-6, przedstawiono w Tabeli 1. Znacznie więcej dzieci z wiremią HHV-6 miało gorączkę i zapalenie ucha, podczas gdy HHV -6-ujemna grupa częściej miała zapalenie żołądka i jelit
[podobne: parafia łososina górna, metypred ulotka, parafia tokarnia ]